52
CASE FILES: BIOCHEMISTRY
[5.3]
The following diagram schematically represents the life cycle of the
human immunodeficiency virus (HIV). Which of the labeled steps best
indicates the site at which an HIV protease inhibitor disrupts the cycle?
HIV binds
to CD4
receptors
HIV enters
host cell
e
Assembly of new
'
virus particles
D
Translation of viral core &
D '
envelope proteins
Synthesis of DNA
»
"
from HIV RNA
A
I
Integration of HIV
b
DNA into host DNA
B
I
Synthesis of HIV RNA
_
followed by splicing
C
I
Release of full-length HIV
into cell cytoplasm
[5.4]
Given the mRNA nucleotide sequence, choose the best protein sequence
that will likely result. (Use the amino acid table in Questions [13.2] and
[13.3] in Case 13, keeping in mind that [T] and [U] are analogous).
mRNA 5' AUCGGAUGUCUCGGGUUCUGUAAAGGUAAUC 3'
A. Met-Ser-Arg-Val-Leu
B. Ser-Arg-Val-Leu
C. Met-Leu-Ser-Val
D. Ser-Arg-Val-Phe-Phe
E. Pro-Ser-Val-Gly
A nsw ers
[5.1]
D. The nucleoside/nucleotide analogs like azidothymidine (AZT) and
didanosine are incorporated into the DNA synthesized by HIV reverse
transcriptase. Because they do not have a 3'-hydroxyl group, they
cannot form a bond with the next nucleotide and the chain is termi-
nated. Host cell DNA synthesis is not affected because of the nuclear
DNA repair mechanisms.
[5.2]
A. In the Western blot confirmatory test, standard HIV proteins
(gag,
pol,
and
env)
are separated by gel electrophoresis and then blotted
onto a nitrocellulose membrane. The membrane is then incubated
with the patient’s serum. Any anti-HIV antibodies will bind to the
respective HIV protein on the membrane. Finally, a labeled antihu-
man antibody is added to indicate the presence of any anti-HIV anti-
body binding. The test is highly specific; that is, a positive result is
highly indicative of HIV infection.
previous page 66 Case Files   Biochemistry read online next page 68 Case Files   Biochemistry read online Home Toggle text on/off